Table 1

Primer and probe lists.

GENE

FORWARD PRIMER

REVERSE PRIMER

PROBE (5' FAM, 3' TAMRA)


Arl6ip2

TTTGGAATGAAGTGTTTGTGATTGA

GGCACCCTGGGTATCCATTA

AGACCTAATGGAACAAAAGTGGCTGTGCTG


Actb

GCTTCTTTGCAGCTCCTTCGT

CCAGCGCAGCGATATCG

CGGTCCACACCCGCCACCAG


Bdnf I

GCAAAGCCGAACTTCTCACAT

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf IIa

ACAGAGCCAGCGGATTTGTC

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf IIb

AGTTGGCTTCCTAGCGGTGTAG

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf IIc

TGCAACTCTTTATCACCAGGATCTA

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf III

GGGCCGGATGCTTCCTT

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf IV

CTGCCTTGATGTTTACTTTGACAAG

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf V

GGGATCCGAGAGCTTTGTG

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf VI

TCCTGAGGAAGTGAAAGTTTTGACT

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf VII

GATTGCTGAAAATGGTGTCGTAAA

GCAACCGAAGTATGAAATAACCATAG

TTCCACCAGGTGAGAAGAGTGATGACCAT


Bdnf VIII

CTGGATGCCGCAAACATGTC

CTGCCGCTGTGACCCACTC

TCACACACGCTCAGCTCCCCACGG


Cnr1

CACAAGCACGCCAATAACACA

ACAGTGCTCTTGATGCAGCTTTC

CCAGCATGCACAGGGCCGC


Darpp32

CCCGACAGGTGGAGATGATC

GCTGCACAGCTTTCAGTGATG

CTGCCATGCTTTTCCGGGTCTCAGA


Drd2

ACACCACTCAAGGGCAACTGT

GGCGGGCAGCATCCA

CCCTGAGGACATGAAACTCTGCACCG


Grin1

TCAGTGTGTGAGGACCTCATCTCT

GAGTGAAGTGGTCGTTGGGAGTA

CAGGTCTACGCTATCCTAGTTAGTCACCCGCC


Hdh

CTCAGAAGTGCAGGCCTTACCT

GATTCCTCCGGTCTTTTGCTT

TGAATCTTCTTCCATGCCTGACCCGA


HD (transgenic)

GCTGCACCGACCGTGAGT

CGCAGGCTGCAGGGTTAC

CAGCTCCCTGTCCCGGCGG


Igfbp5

AAGGATTCTACAAGAGAAAGCAGTGTAA

ACTTGTCCACACACCAGCAGAT

TCCCGTGGCCGCAAACGTG


Kcnk2

GACTACGTGGCAGGTGGATCA

GCCAGCCCAACGAGGAT

AATATCTGGACTTCTACAAGCCTGTGGTGTGGT


Nab2

GGGAGGGCAAACAGCTTAGC

AGTGTTGTCCCTCATGCAGAACT

ACCATCAACGAGGCTGCTGCC


Nr4a2

ATTTCCTCGAAAACTCCAATAACTCT

TGAGGCGAGGACCCATACTG

CTGAAGCCATGCCTTGTGTTCAGGC


Pcp4

CTGAGCTGTTCTGTGGGACCTA

CGCTCCGGCACTTTGTCT

CTGCGGAGTCAGGCCAACATGA


Penk1

ATGCAGCTACCGCCTGGTT

GCAGCTGTCCTTCACATTCCA

AGGCGACATCAATTTCCTGGCGTG


Polr2a

GGTGCTGAGTGAGAAGGATGTAGA

ATGCCCAGTACCGTGAAGATCT

TGCGCACCACGTCCAATGATATTGTG


Psme1

TGATGACCAACCTTCACACCAA

TCACCCCTCTCGGAGAAGTACT'

CTGGAAGGCTTCCACACGCAGATCTCC


Sez6

TGTGCCAGTGGGACCTAAGC

TCACAGACATATTGCACAGTTGCT

CATGCCAGAGAGTGACATCTTGCCA


Tbr2

CAAAGGCTTCCGGGACAAC

GGGAGATGGAGTTAACCTGTCATTT

CGATTCCATGTACACGGCTTCAG


UchL1

GGTACCATCGGGTTGATCCA

AACTGTTTCAGGACGGATCCA

AACCAAGACAAGCTGGAATTTGAGGA


Wdr6

GAACAAGCACAAGATGATCAAGGT

GCCTATCGTTGTCAAGCTCACA

TGAGACCAGGTACATGTCTCTTGCTATT


The forward and reverse primer sequences, together with the Taqman probe sequences for each gene routinely used in our laboratory are listed.

KEY: Arl6ip2 (ADP-ribosylation factor-like 6 interacting protein 2); Actb (beta-actin); Bdnf (Brain-derived neurotrophic factor; Roman numerals refer to promoter-specific amplification); Cnr1 (Cannabinoid receptor 1); Darpp32 (Dopamine and cAMP regulated neuronal phosphoprotein, also known as Ppp1r1b, protein phosphatase 1, regulatory subunit 1B); Drd2 (Dopamine D2 receptor); Grin1 (glutamate receptor, ionotropic, NMDA1 {zeta 1}); Hdh (Murine huntington's disease gene homologue); Htt (Human Huntington's disease gene, used to detect human exon 1 transgene); Igfbp5 (insulin-like growth factor binding protein 5 precursor); Kcnk2 (potassium channel, subfamily K, member 2); Nab2 (Ngfi-A binding protein 2); Nr4a2 (nuclear receptor subfamily 4, group A, member 2); Pcp4 (Purkinje cell protein 4); Penk1 (Preproenkephalin); Polr2a (RNA polymerase II {DNA directed} polypeptide A); Psme1 (proteasome activator 28-α subunit); Sez6 (seizure related gene 6); Tbr2 (eomesodermin homolog), Uchl1 (ubiquitin carboxyl-terminal hydrolase L1), Wdr6 (WD repeat domain 6).

Benn et al. Molecular Neurodegeneration 2008 3:17   doi:10.1186/1750-1326-3-17

Open Data