<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1750-1326-2-1</ui>
   <ji>1750-1326</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Angiotensin type 1 receptor antagonist losartan, reduces MPTP-induced degeneration of dopaminergic neurons in substantia nigra</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Grammatopoulos</snm>
               <mi>N</mi>
               <fnm>Tom</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>thangram@hotmail.com</email>
            </au>
            <au id="A2">
               <snm>Jones</snm>
               <mi>M</mi>
               <fnm>Susan</fnm>
               <insr iid="I1"/>
               <email>Susan.Jones@UCHSC.edu</email>
            </au>
            <au id="A3">
               <snm>Ahmadi</snm>
               <mi>A</mi>
               <fnm>Ferogh</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>Ferogh.Ahmadi@UCHSC.edu</email>
            </au>
            <au id="A4">
               <snm>Hoover</snm>
               <mi>R</mi>
               <fnm>Brian</fnm>
               <insr iid="I3"/>
               <email>Brain.Hoover@UCHSC.edu</email>
            </au>
            <au id="A5">
               <snm>Snell</snm>
               <mi>D</mi>
               <fnm>Lawrence</fnm>
               <insr iid="I3"/>
               <email>Larry.Snell@UCHSC.edu</email>
            </au>
            <au id="A6">
               <snm>Skoch</snm>
               <fnm>Jesse</fnm>
               <insr iid="I1"/>
               <email>Jesse.Skoch@UCHSC.edu</email>
            </au>
            <au id="A7">
               <snm>Jhaveri</snm>
               <mi>V</mi>
               <fnm>Vimal</fnm>
               <insr iid="I3"/>
               <email>vvj27@bu.edu</email>
            </au>
            <au id="A8">
               <snm>Poczobutt</snm>
               <mi>M</mi>
               <fnm>Andy</fnm>
               <insr iid="I1"/>
               <email>Andy.Poczobutt@UCHSC.edu</email>
            </au>
            <au id="A9">
               <snm>Weyhenmeyer</snm>
               <mi>A</mi>
               <fnm>James</fnm>
               <insr iid="I4"/>
               <email>weyhen@uillinois.edu</email>
            </au>
            <au id="A10" ca="yes">
               <snm>Zawada</snm>
               <fnm>W Michael</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>Mike.Zawada@UCHSC.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Division of Clinical Pharmacology and Toxicology, Department of Medicine, Denver and Health Sciences Center, Denver, Colorado 80262, USA</p>
            </ins>
            <ins id="I2">
               <p>Neuroscience Program, Department of Medicine, Denver and Health Sciences Center, Denver, Colorado 80262, USA</p>
            </ins>
            <ins id="I3">
               <p>Department of Pharmacology, University of Colorado at Denver and Health Sciences Center, Denver, Colorado 80262, USA</p>
            </ins>
            <ins id="I4">
               <p>Department of Cell and Structural Biology, University of Illinois, Urbana, Illinois 61801, USA</p>
            </ins>
         </insg>
         <source>Molecular Neurodegeneration</source>
         <issn>1750-1326</issn>
         <pubdate>2007</pubdate>
         <volume>2</volume>
         <issue>1</issue>
         <fpage>1</fpage>
         <url>http://www.molecularneurodegeneration.com/content/2/1/1</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17224059</pubid>
               <pubid idtype="doi">10.1186/1750-1326-2-1</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>11</day>
               <month>9</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>15</day>
               <month>1</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>15</day>
               <month>1</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Grammatopoulos et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Recent attention has focused on understanding the role of the brain-renin-angiotensin-system (RAS) in stroke and neurodegenerative diseases. Direct evidence of a role for the brain-RAS in Parkinson's disease (PD) comes from studies demonstrating the neuroprotective effect of RAS inhibitors in several neurotoxin based PD models. In this study, we show that an antagonist of the angiotensin II (Ang II) type 1 (AT<sub>1</sub>) receptor, losartan, protects dopaminergic (DA) neurons against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) toxicity both in primary ventral mesencephalic (VM) cultures as well as in the substantia nigra pars compacta (SNpc) of C57BL/6 mice (Fig. <figr fid="F1">1</figr>).</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>In the presence of exogenous Ang II, losartan reduced MPP<sup>+ </sup>(5 &#956;M) induced DA neuronal loss by 72% <it>in vitro</it>. Mice challenged with MPTP showed a 62% reduction in the number of DA neurons in the SNpc and a 71% decrease in tyrosine hydroxylase (TH) immunostaining of the striatum, whereas daily treatment with losartan lessened MPTP-induced loss of DA neurons to 25% and reduced the decrease in striatal TH<sup>+ </sup>immunostaining to 34% of control.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our study demonstrates that the brain-RAS plays an important neuroprotective role in the MPTP model of PD and points to AT<sub>1 </sub>receptor as a potential novel target for neuroprotection.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Parkinson's disease (PD) was originally described in 1817 by James Parkinson and since then there has been much progress in determining the etiology of the disease <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. There is now clear evidence showing that the primary pathological feature of PD is the loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc) <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Insights into the mechanisms responsible for PD have come from epidemiological studies and through animal models of DA neurodegeneration <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. Treatment of rodents and non-human primates with neurotoxins such as 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), 6-hydroxydopamine <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp> and rotenone <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> have helped us understand that oxidative stress, mitochondrial respiration dysfunction and protein aggregation are primary mediators of the dopaminergic neurodegeneration <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Even with some understanding of how DA neurons are lost in PD, there is still no effective therapy to halt or slow down the progression of the disease. Several clinical studies have promised the development of new therapies for prevention of dopaminergic neurodegeneration, such as through the use of resagiline, co-enzyme Q10, memantine and others <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. However, additional research is needed to identify new molecular targets, which may help find ways to prevent or reduce the DA neuronal loss in PD. This study explores the hypothesis that the renin-angiotensin system (RAS) is a potential target for preventing the loss of DA neurons.</p>
         <p>The renin-angiotensin system is best known for its role in regulating blood pressure, activation of sympathetic pathways, stimulation of vasopressin release, regulating drinking behavior and cerebral blood flow <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. Only recently has it been discovered that all the required components of the RAS, such as renin, angiotensinogen, angiotensin converting enzyme (ACE), angiotensin II (Ang II) and the Ang II (AT) receptors, are present in the mammalian brain <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. Ang II is the primary agonist of the RAS and has similar affinities for the two primary AT receptors, AT<sub>1 </sub>and AT<sub>2</sub>. The AT<sub>1 </sub>receptor was originally identified by the selective binding of a non-peptide receptor antagonist, 2-n-butyl-4-chloro-5-hydroxy-methyl-1-[(2'-(1H)-tetrazol-5-yl)biphenyl-4-yl)methyl]imidazol potassium salt (DuP 753, losartan), whereas the AT<sub>2</sub>, receptor was identified by the selective binding of a non-peptide receptor antagonist, PD123319 <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Both the AT<sub>1 </sub>and AT<sub>2 </sub>receptors are known to be members of the seven-transmembrane spanning G-protein coupled receptor (GPCR) superfamily <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. AT<sub>1 </sub>receptor signaling activates kinases through a protein kinase C (PKC) pathway and AT<sub>2 </sub>receptor signaling activates phosphatases through a phospholipase-2 (PLA2) pathway. The two receptor types have been suggested to have opposing actions <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>Recently, increased attention has focused on understanding the role of the brain-RAS in stroke and neurodegenerative diseases such as Alzheimer's disease and multiple sclerosis <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. Several groups have proposed the possibility that the brain-RAS may also have a role in PD. One genetic study, suggests that polymorphisms in the gene encoding for ACE may be a risk factor for PD <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Examination of human postmortem brain tissues has shown a loss of both AT<sub>1 </sub>and AT<sub>2 </sub>receptor binding sites in the substantia nigra of PD patients, suggesting that PD-induced neurodegeneration may involve AT receptor expressing cells <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. The brain-RAS is also involved in maintaining tyrosine hydroxylase (TH) transcription and catecholamine synthesis <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. Recently, Ang II was shown to increase the number of DA neurons <it>in vitro</it>, via an action on the AT<sub>2 </sub>receptor <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. More direct evidence of a role for the brain-RAS in PD comes from studies demonstrating the neuroprotective effects of ACE inhibitors in MPTP and 6-hydroxydopamine-treated rodents <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. We have previously found that <it>in vitro </it>antagonism of the AT<sub>1 </sub>receptor with losartan, and subsequent activation of the AT<sub>2 </sub>receptor with exogenous Ang II, protects primary ventral mesencephalic DA neurons against the mitochondrial complex I inhibitor, rotenone <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. In the current study, we demonstrate for the first time that the AT<sub>1 </sub>receptor antagonist, losartan, can protect DA neurons of the SNpc against MPTP-induced toxicity in C57BL/6 mice. These studies raise the possibility that AT<sub>1 </sub>receptor antagonism may be a novel method for preventing the loss of DA neurons.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Timeline of the experimental design.</p>
            </caption>
            <text>
               <p>Timeline of the experimental design. Arrows point to when subcutaneous injections of losartan (90 mg/kg) and intraperitoneal injections of MPTP-hydrochloride (20 mg/kg) were administered and when the animals were sacrificed.</p>
            </text>
            <graphic file="1750-1326-2-1-1"/>
         </fig>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Angiotensin II protects dopaminergic neurons in vitro from MPP<sup>+ </sup>toxicity only in the presence of the AT<sub>1 </sub>receptor antagonist losartan</p>
            </st>
            <p>To study the effects of the RAS on MPP<sup>+</sup>-induced neurotoxicity <it>in vitro</it>, primary rat E15 VM cultures were grown for 6 days and then treated with MPP<sup>+ </sup>(1&#8211;100 &#956;M) for 48 hrs. MPP<sup>+</sup>-treated cultures showed a dose-dependent loss of TH immunoreactive DA neurons, with a statistically significant loss of 15.9 &#177; 3% to 71.8 &#177; 6% over a dose range of 1 to 100 &#956;M (Fig. <figr fid="F2">2</figr>).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Angiotensin II protects DA neurons <it>in vitro </it>from MPP<sup>+ </sup>toxicity only in the presence of the AT<sub>1 </sub>receptor antagonist losartan</p>
               </caption>
               <text>
                  <p>Angiotensin II protects DA neurons <it>in vitro </it>from MPP<sup>+ </sup>toxicity only in the presence of the AT<sub>1 </sub>receptor antagonist losartan. (<b>a</b>) Microscopic view of TH<sup>+ </sup>(DA) neurons in VM cultures in the presence of media or MPP<sup>+ </sup>(10 &#956;M) alone, MPP<sup>+ </sup>with Ang II (100 nM), and MPP<sup>+ </sup>with either losartan (1 &#956;M) or PD123319 (1 &#956;M). Scale bar equal to 50 &#956;m. (<b>b</b>) Quantification of TH<sup>+ </sup>neuron counts in VM cultures treated with increasing concentrations of MPP<sup>+ </sup>(1&#8211;100 &#956;M) in the presence or absence of Ang II (100 nM) and AT receptor antagonists, losartan (1 &#956;M) (AT<sub>1</sub>R) and/or PD123319 (1 &#956;M) (AT<sub>2</sub>R). Results are mean &#177; SEM. (n = 4&#8211;6). (*) Represents a significant difference (p &#8804; 0.05, One-way ANOVA followed by Newman-Keuls post-hoc test) from MPP<sup>+</sup>.</p>
               </text>
               <graphic file="1750-1326-2-1-2"/>
            </fig>
            <p>In an effort to determine whether AT receptor activation affects the resistance of DA neurons to MPP<sup>+ </sup>toxicity, VM cultures were treated with Ang II (100 nM) prior to the addition of MPP<sup>+ </sup>(1&#8211;100 &#956;M). Select VM cultures were also pretreated with the AT<sub>1 </sub>receptor antagonist losartan (1 &#956;M) and/or the AT<sub>2 </sub>receptor antagonist PD123319 (1 &#956;M), prior to the addition of Ang II (Fig. <figr fid="F2">2</figr>). TH<sup>+ </sup>neuronal counts were determined 48 hrs after the addition of MPP<sup>+</sup>. MPP<sup>+ </sup>dose response conditions were analyzed by one-way ANOVA followed by a Newman-Keuls post-hoc test. This analysis showed that MPP<sup>+</sup>-treated VM cultures pretreated with Ang II (100 nM), in the presence of losartan (1 &#956;M), had a statistically significant reduction in DA neuronal loss when compared to MPP<sup>+ </sup>exposed VM cultures pretreated with Ang II alone or in the presence of PD123319 (Fig. <figr fid="F2">2</figr>). VM cultures treated with Ang II and losartan showed a 71.6 &#177; 6% and 48.3 &#177; 10% reduction in MPP<sup>+</sup>-induced DA neuronal loss when compared to 5 &#956;M and 10 &#956;M MPP<sup>+ </sup>alone treated VM cultures, respectively (Fig. <figr fid="F2">2</figr>). In combination, both AT receptor antagonists in the presence of Ang II (100 nM) did not significantly alter MPP<sup>+ </sup>toxicity. Ang II alone or in the presence of PD123319, did not provide significant neuroprotection (Fig. <figr fid="F2">2</figr>). Both AT receptor antagonists, in the absence of exogenous Ang II, also did not affect MPP<sup>+ </sup>toxicity (data not shown). In addition, VM cultures treated with Ang II (100 nM) and losartan (1 &#956;M) 15 to 60 min after the addition of MPP<sup>+ </sup>(10 &#956;M) and assayed 48 hrs later, were not neuroprotected against MPP<sup>+ </sup>(data not shown). This suggests that modification of downstream signaling of the angiotensin pathway is required prior to neurotoxin exposure.</p>
         </sec>
         <sec>
            <st>
               <p>In vitro AT receptor expression profile in primary VM cultures</p>
            </st>
            <p>Since downstream signaling of Ang II is dependent on specific AT receptor distribution, we began examining AT<sub>1 </sub>and AT<sub>2 </sub>receptor expression in DA neurons <it>in vitro</it>. While the majority (95%) of TH<sup>+ </sup>neurons expressed the AT<sub>1 </sub>receptor using two different antibodies (Abcam and Santa Cruz) (Fig. <figr fid="F3">3a</figr>), only 65% of the TH<sup>+ </sup>neurons expressed the AT<sub>2 </sub>receptor (detectable only with Abcam antibody) (Fig. <figr fid="F3">3b</figr>). Because of the difference in AT<sub>1 </sub>and AT<sub>2 </sub>receptor expression in DA neurons, the AT receptor profiles of other VM culture cell types were subsequently examined.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p><it>In vitro </it>AT receptor expression profiles in primary rat VM cultures</p>
               </caption>
               <text>
                  <p><it>In vitro </it>AT receptor expression profiles in primary rat VM cultures. (<b>a</b>) VM cultures were stained for TH (DA neurons) (green) (<b>A</b>), AT<sub>1 </sub>receptor (red) (<b>B</b>), and counter stained with Hoechst dye (blue nuclear stain) (<b>C</b>). Merged image of A-C (<b>D</b>). Panels (<b>E-H</b>) are merged images of AT<sub>1 </sub>receptor (green) co-labeling with either nestin (neural progenitors; red) (<b>E</b>), GFAP (astrocytes; red) (<b>F</b>), NeuN (neurons; red) (<b>G</b>), or MAP2 (neuronal marker; red) (<b>H</b>), counter stained with Hoechst dye (blue nuclear stain) and visualized under fluorescence microscopy (&#215;400). Arrowheads indicate examples of cells of various phenotypes that contain AT<sub>1 </sub>receptors. Scale bar equal to 50 &#956;m. (<b>b</b>) VM cultures were stained for TH (green) (<b>A</b>), AT<sub>2 </sub>receptor (red) (<b>B</b>), and counter stained with Hoechst dye (<b>C</b>). Merged image of A-C (<b>D</b>). Panels (<b>E-H</b>) are merged images of AT<sub>2 </sub>receptor (green) double stained with either nestin (red) (<b>E</b>), GFAP (red) (<b>F</b>), NeuN (red) (<b>G</b>), or MAP2 (red) (<b>H</b>), counter stained with Hoechst dye and visualized under fluorescence microscopy. Arrowheads point to various cell types positive for the AT<sub>2 </sub>receptor (&#215;400). Scale bar equals 50 &#956;m. (<b>c</b>) Panels (<b>A-D</b>) show co-expression of AT<sub>1 </sub>(red) (<b>B</b>) and AT<sub>2 </sub>(green) (<b>A</b>) receptors counter stained with Hoechst dye (<b>C</b>). Merged image of A-C (<b>D</b>). Arrowheads show examples of cells co-expressing both types of AT receptors.</p>
               </text>
               <graphic file="1750-1326-2-1-3"/>
            </fig>
            <p>AT<sub>1 </sub>receptors were co-expressed in cells immunopositive for nestin (neural progenitors), GFAP (astrocytes), NeuN and MAP2 (neurons) (Fig. <figr fid="F3">3a</figr>). AT<sub>2 </sub>receptors were expressed in nestin, GFAP, NeuN and MAP2 stained cells (Fig. <figr fid="F3">3b</figr>). Approximately half of all cells showed double labeling for both AT receptors (Fig. <figr fid="F3">3c</figr>).</p>
            <p>In an effort to determine specificity of the antibodies used for the detection of the AT<sub>1 </sub>and AT<sub>2 </sub>receptors we performed western immunoblot analysis of these receptors in N27 dopaminergic cells, which were derived from immortalized E12 VM. As seen in figure <figr fid="F4">4</figr>, both antibodies detect the AT<sub>1A </sub>and the AT<sub>1B </sub>and AT<sub>2 </sub>receptors in these dopaminergic cells.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Western immunoblot detection of the AT receptors in N27 dopaminergic cell line using either the Abcam or the Santa Cruz antibodies</p>
               </caption>
               <text>
                  <p>Western immunoblot detection of the AT receptors in N27 dopaminergic cell line using either the Abcam or the Santa Cruz antibodies. The AT<sub>1 </sub>receptor is detected as two proteins representing the AT<sub>1A </sub>(43 kDa) and AT<sub>1B </sub>(53 kDa) encoded by two different genes. The AT<sub>2 </sub>is detected at 43 kDa.</p>
               </text>
               <graphic file="1750-1326-2-1-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>In vivo AT receptor expression profile in dopaminergic neurons of the substantia nigra pars compacta (SNpc)</p>
            </st>
            <p>To better understand the role of the brain-RAS in preventing DA neuronal loss <it>in vivo</it>, we determined the AT receptor expression profile of TH<sup>+ </sup>cells of the SNpc of adult male C57BL/6 mice by immunohistochemistry. As seen in figure <figr fid="F5">5</figr>, TH<sup>+ </sup>neurons in the intact SNpc expressed a similar AT receptor profile to that found in VM cultures, with the majority of TH<sup>+ </sup>cells expressing the AT<sub>1 </sub>receptor (95%), but the AT<sub>2 </sub>receptor was expressed in fewer SNpc dopamine neurons (45%); detectable only with the Abcam antibody (Fig. <figr fid="F5">5</figr>). Because of the inherently semi-quantitative nature of the immunohistochemical analysis, we have also employed an alternative technique for assaying the AT<sub>2 </sub>receptor expression by determining the levels of Agtr2 mRNA by real-time RT-PCR, in TH<sup>+ </sup>neurons of the SNpc and ventral tegmental area (VTA), isolated by laser capture microdissection (LCM). Low levels of Agtr2 mRNA were detected in these cells and there was no significant difference between TH<sup>+ </sup>neurons from the SNpc and the VTA (Fig. <figr fid="F6">6</figr>). Animal and cell culture treatments with MPTP or MPP<sup>+ </sup>did not change AT receptor immunoreactivity to any detectable level (data not shown). In addition, we did not observe any differences in the AT receptor profile between TH<sup>+ </sup>neurons of the SNpc and TH<sup>+ </sup>neurons of the VTA (data not shown), indicating that previously reported lower susceptibility to MPTP of the TH<sup>+ </sup>neurons from the VTA is not likely due to a difference in AT receptor distribution.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p><it>In vivo </it>AT receptor profile of DA neurons in the substantia nigra pars compacta (SNpc) of adult C57BL/6 male mice</p>
               </caption>
               <text>
                  <p><it>In vivo </it>AT receptor profile of DA neurons in the substantia nigra pars compacta (SNpc) of adult C57BL/6 male mice. Coronal sections (40 &#956;m) were stained for (A) AT<sub>1 </sub>receptor (red) or (D) AT<sub>2 </sub>receptor (red), (B, E) TH (DA neurons) (green) and (C, F) represent merged images. Scale bar equals to 200 &#956;m.</p>
               </text>
               <graphic file="1750-1326-2-1-5"/>
            </fig>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Detection of Agtr2, TH and GADH mRNAs by real time RT-PCR in TH<sup>+ </sup>neurons of the SNpc and VTA</p>
               </caption>
               <text>
                  <p>Detection of Agtr2, TH and GADH mRNAs by real time RT-PCR in TH<sup>+ </sup>neurons of the SNpc and VTA. Relative concentrations were determined using a standard curve of known concentrations of whole brain cDNAs.</p>
               </text>
               <graphic file="1750-1326-2-1-6"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Losartan protects SNpc dopaminergic neurons from MPTP toxicity</p>
            </st>
            <p>A severe loss (61.8 &#177; 10%) of DA neurons was observed in the SNpc of MPTP-treated mice compared to control mice treated with saline (Fig. <figr fid="F7">7</figr>). By contrast, the number of DA neurons lost in MPTP-treated mice receiving losartan was only 25.0 &#177; 16%, when compared to saline-treated mice. These results show that pretreatment and daily dosing with losartan can reduce MPTP-induced DA neuronal loss in the SNpc by 60% (p &lt; 0.05). In an effort to confirm that the injected MPTP regimen induced DA neuronal loss and not just a down-regulation of TH immunoreactivity, we determined the total number of cells in the SNpc by Nissl staining. Nissl staining of the SNpc revealed a total cell loss of 54.1 &#177; 1% in MPTP-treated mice, demonstrating that the MPTP regimen resulted in DA neuronal cell loss (Fig. <figr fid="F7">7</figr>). MPTP-treated mice receiving losartan had a 44.9 &#177; 10% loss of total cells, which was not statistically different from the cell loss observed in mice receiving only MPTP. In mice treated with losartan alone, the numbers of DA neurons or Nissl-stained cells remained unaltered when compared to saline control mice (Fig. <figr fid="F7">7</figr>). Our results show that the AT<sub>1 </sub>receptor antagonist, losartan, reduces MPTP-induced DA neuronal loss in the SNpc of C57BL/6 mice.</p>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>Losartan protects DA neurons of the SNpc from MPTP toxicity</p>
               </caption>
               <text>
                  <p>Losartan protects DA neurons of the SNpc from MPTP toxicity. (<b>a</b>) TH immunoreactive neurons and Nissl stained cells in the SNpc from mice treated with saline, MPTP, MPTP + losartan or losartan alone. Scale bars equal to 100 &#956;m. Saline panel shows a representative contour selection of the A9 region. The Cell Selection panel shows an example of counted TH<sup>+ </sup>neurons (indicated with arrows) or Nissl-stained cells with large nuclei (indicated with arrows) and excluded Nissl-stained cells with small nuclei (indicated with arrowheads). (<b>b</b>) Quantification of the number of TH<sup>+ </sup>neurons and Nissl stained cells in the SNpc, revealed a significant decrease in the number TH<sup>+ </sup>neurons in MPTP treated mice when compared to saline control treated animals. MPTP-injected mice treated daily with losartan significantly decreased the MPTP-induced loss of TH<sup>+ </sup>neurons in the SNpc. Significance is indicated by (#) when compared to MPTP-alone injected mice and (*) when compared to saline-alone injected mice (p &#8804; 0.05, One-way ANOVA followed by Newman-Keuls post-hoc test). Data are represented as mean &#177; SEM, n = 4&#8211;5 for TH immunostain and n = 3 for Nissl stain.</p>
               </text>
               <graphic file="1750-1326-2-1-7"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Losartan protects striatal nerve terminals from MPTP-induced toxicity</p>
            </st>
            <p>Significant differences between treated animal groups were also observed when measuring striatal TH<sup>+ </sup>immunostaining densities. Mice treated with MPTP showed a significant 70.6 &#177; 7% decrease in striatal TH<sup>+ </sup>staining when compared to saline control animals (Fig. <figr fid="F8">8</figr>). Daily treatment with losartan significantly reduced the loss of striatal TH immunoreactivity in the striatum of MPTP-treated mice by 53.2 &#177; 8% when compared to MPTP-alone treated mice (Fig. <figr fid="F8">8</figr>). Animals treated with losartan alone showed no significant change in TH immunoreactivity when compared to saline control animals (Fig. <figr fid="F8">8</figr>). Our results demonstrate that inhibition of the AT<sub>1 </sub>receptor with losartan significantly reduces MPTP-induced denervation of striatal nerve terminals.</p>
            <fig id="F8">
               <title>
                  <p>Figure 8</p>
               </title>
               <caption>
                  <p>Losartan prevents MPTP-induced denervation of the striatum</p>
               </caption>
               <text>
                  <p>Losartan prevents MPTP-induced denervation of the striatum. (a) Coronal sections of TH immunoreactivity in the striatum of mice treated with saline, MPTP, MPTP + losartan or losartan alone. Scale bars equal to 500 &#956;m. (b) Quantification of striatal densities, showing a significant decrease in the percent of TH<sup>+ </sup>immunoreactivity in MPTP-treated mice. MPTP-injected mice treated daily with losartan had significantly higher levels of TH<sup>+ </sup>immunoreactivity in the striatum when compared to MPTP alone-injected mice (*, p &#8804; 0.05, One-way ANOVA followed by Newman-Keuls post-hoc test). Data are represented as mean &#177; SEM, (n = 4&#8211;5).</p>
               </text>
               <graphic file="1750-1326-2-1-8"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Losartan does not interfere with transport of MPTP into the brain and its conversion to MPP<sup>+ </sup>in C57BL/6 mice</p>
            </st>
            <p>The possibility that losartan may interfere with brain uptake or metabolism of MPTP was examined in the SN and striatum of mice injected with MPTP. Sixty minutes after the last MPTP injection, the SN and striatum were dissected and MPP<sup>+ </sup>levels were determined through HPLC. No differences in nigral and striatal MPP<sup>+ </sup>levels were observed regardless of whether MPTP-injected mice were treated with losartan or not (Table <tblr tid="T1">1</tblr>). These findings highlight the fact that losartan does not interfere with brain uptake or metabolism of MPTP.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Losartan does not interfere with the metabolism and uptake of MPTP.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c cspan="3" ca="left">
                        <p>(a) MPP<sup>+ </sup>levels in the striatum and substantia nigra of C57BL/6 mice</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Treated Groups</p>
                     </c>
                     <c ca="left">
                        <p>Striatum</p>
                     </c>
                     <c ca="left">
                        <p>Substantia nigra</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MPTP</p>
                     </c>
                     <c ca="left">
                        <p>0.27 &#177; 0.03 &#956;g MPP<sup>+</sup>/g tissue</p>
                     </c>
                     <c ca="left">
                        <p>0.28 &#177; 0.12 &#956;g MPP<sup>+</sup>/g tissue</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MPTP+ Losartan</p>
                     </c>
                     <c ca="left">
                        <p>0.26+0.04 &#956;g MPP<sup>+</sup>/g tissue</p>
                     </c>
                     <c ca="left">
                        <p>0.22 &#177; 0.05 &#956;g MPP<sup>+</sup>/g tissue</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3" ca="left">
                        <p>(b) Dopamine uptake in ventral mesencephalic cultures</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Control</p>
                     </c>
                     <c ca="left">
                        <p>68.1 &#177; 11.2 fmol/sec</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Losartan (1 &#956;M)</p>
                     </c>
                     <c ca="left">
                        <p>72.7 &#177; 7.9 fmol/sec</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Losartan (10 &#956;M)</p>
                     </c>
                     <c ca="left">
                        <p>76.2 &#177; 14.5 fmol/sec</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>(a) MPP<sup>+ </sup>levels in the striatum and substantia nigra of C57BL/6 mice were measured by HPLC analysis 60 min after MPTP injection regimen and were compared to MPTP injected mice pretreated with the AT<sub>1 </sub>receptor antagonist losartan (n = 3). (b) Dopamine uptake levels in VM cultures treated with media control, 1 and 10 &#956;M losartan (n = 3).</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Losartan does not interfere with dopamine uptake in VM cultures</p>
            </st>
            <p>To rule out the possibility that losartan-mediated neuroprotection was a result of inhibition of the dopamine transporter (DAT) and subsequent reduction of MPP<sup>+ </sup>entry into DA neurons, VM cultures were treated with losartan (1 and 10 &#956;M) and DA uptake levels were determined. Losartan (1 and 10 &#956;M) did not alter DA uptake in VM cultures (Table <tblr tid="T1">1</tblr>). This demonstrates that losartan does not interfere with the function of the DAT.</p>
         </sec>
         <sec>
            <st>
               <p>Losartan reduces arterial blood pressure in C57BL/6 mice</p>
            </st>
            <p>In an effort to determine if losartan reduces blood pressure (BP) levels in C56BL/6 male mice, we took arterial BP measurements of mice treated with saline or losartan. In order to maintain constant BP levels, losartan was administered in drinking water at a dose of 0.18 mg/mL. Table <tblr tid="T2">2</tblr> shows the systolic and diastolic measurements after this dosing regimen. Losartan alone reduced mean BP by 24 &#177; 3% when compared to saline treated controls (Table <tblr tid="T2">2</tblr>).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Losartan reduces arterial blood pressure in C57BL/6 mice.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Systolic</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Treatment</p>
                     </c>
                     <c ca="right">
                        <p>Saline</p>
                     </c>
                     <c ca="right">
                        <p>Losartan</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mean</p>
                     </c>
                     <c ca="right">
                        <p>124.28</p>
                     </c>
                     <c ca="right">
                        <p>96.43</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Std. error of mean (SEM)</p>
                     </c>
                     <c ca="right">
                        <p>3.53</p>
                     </c>
                     <c ca="right">
                        <p>3.45</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Sample size (N)</p>
                     </c>
                     <c ca="right">
                        <p>39</p>
                     </c>
                     <c ca="right">
                        <p>43</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Diastolic</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Treatment</p>
                     </c>
                     <c ca="right">
                        <p>Saline</p>
                     </c>
                     <c ca="right">
                        <p>Losartan</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mean</p>
                     </c>
                     <c ca="right">
                        <p>101.24</p>
                     </c>
                     <c ca="right">
                        <p>75.31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Std. error of mean (SEM)</p>
                     </c>
                     <c ca="right">
                        <p>4.68</p>
                     </c>
                     <c ca="right">
                        <p>3.21</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Sample size (N)</p>
                     </c>
                     <c ca="right">
                        <p>33</p>
                     </c>
                     <c ca="right">
                        <p>38</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Losartan (0.18 mg/mL) was administered through the drinking water and tail artery blood pressures were recorded non-invasively from awake animals. Data are represented as mean &#177; SEM, (n = 4 animals, >32 readings per animal).</p>
               </tblfn>
            </tbl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The primary goal of this study was to determine if manipulation of brain-RAS with the AT<sub>1 </sub>receptor antagonist, losartan, could prevent the DA neuronal loss caused by the parkinsonism-inducing neurotoxin, MPTP. Losartan in the presence of exogenous Ang II <it>in vitro</it>, was able to significantly reduce the loss of DA neurons induced by MPP<sup>+</sup>. These results are in agreement with our earlier findings demonstrating that antagonism of the AT<sub>1 </sub>receptor with losartan could protect cultured DA neurons from rotenone toxicity <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. In the current study, we also showed that pretreatment of MPTP-lesioned adult C57BL/6 mice with losartan significantly reduced the loss of DA neurons in the SNpc as well as partially spared striatal TH<sup>+ </sup>terminals.</p>
         <p>The brain-RAS has already been identified to have a potential beneficial and therapeutic value as a target against stroke. Several recent studies have shown that peripheral treatment with AT<sub>1 </sub>receptor antagonists is protective against ischemia and reduce the cortical volume of the ischemic lesion <abbrgrp><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr></abbrgrp>. We have recently demonstrated that Ang II, through the actions of the AT<sub>2 </sub>receptor, protects primary cortical neuronal cultures from hypoxic injury <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B38">38</abbr></abbrgrp>. In addition, we also demonstrated that the AT<sub>2 </sub>receptor-mediated neuroprotection is dependent on the delayed rectifier K<sup>+ </sup>channel, Na<sup>+</sup>/Ca<sup>+2 </sup>exchanger and Na<sup>+</sup>/K<sup>+</sup>ATPase <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. And although we have not yet conclusively identified the mechanism(s) of Ang II-mediated DA neuroprotection, our previous work, as well as studies by others, provide some insight into potential mechanisms.</p>
         <p>Several groups have suggested a role for the brain-RAS in PD. A genetic study has implicated polymorphisms of the angiotensin-converting enzyme (ACE) gene as a risk factor for PD <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. In addition, postmortem studies have shown the loss of both AT<sub>1 </sub>and AT<sub>2 </sub>receptor binding sites from the SN in PD patients, suggesting that PD-induced neurodegeneration may involve AT receptor expressing cells <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. The brain-RAS is also involved in maintaining TH transcription and catecholamine synthesis <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. In this study, we observed that almost all DA neurons express the AT<sub>1 </sub>receptor and to a lesser extent they express the AT<sub>2 </sub>receptor, both <it>in vitro </it>and <it>in vivo</it>. Because of the low level of AT<sub>2 </sub>receptor immunostaining, we confirmed the presence of Atgr2 mRNA in TH<sup>+ </sup>neurons by real-time RT-PCR. The immunohistochemical analysis also revealed that all other cell types examined express both AT receptor subtypes <it>in vitro</it>. These results suggest that the observed <it>in vivo </it>neuroprotection may be mediated through the antagonism of the AT<sub>1 </sub>receptor and potentially the subsequent activation of the AT<sub>2 </sub>receptor by Ang II endogenously present in the brain. These data are in agreement with our previous findings which suggest a negative role for the AT<sub>1 </sub>receptor and a neuroprotective role for the AT<sub>2 </sub>receptor which under normal conditions is masked by the opposing role of the AT<sub>1 </sub>receptor <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. An alternative hypothesis is that because DA neurons have low levels of the AT<sub>2 </sub>receptor, it is possible that the observed neuroprotection may be due to the inhibition of downstream signaling of the AT<sub>1 </sub>receptors directly in DA neurons and the preferential activation of AT<sub>2 </sub>receptors in supporting cells, which then indirectly protect the neurons. In support of the indirect theory, astrocytes are known to produce factors such as glial cell line-derived neurotrophic factor (GDNF) and mesencephalic astrocytes-derived neurotrophic factor (MANF), two highly potent neurotrophic factors for DA neurons <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr></abbrgrp>. It should be noted that because losartan did reduce the mean arterial BP in mice, we could not exclude the possibility that the reduction in BP may be contributing to losartan's neuroprotective actions <it>in vivo</it>. Further research is needed to answer many of these questions.</p>
         <p>A recent observation by Rodriguez-Pallares et al <abbrgrp><abbr bid="B31">31</abbr></abbrgrp> describes that developing rat DA neurons derived from E14 VM express the AT<sub>2 </sub>receptor. Our study extends these findings and quantitates the proportion of DA neurons that express the AT<sub>2 </sub>receptor, both in VM cultures (65%) and in the SNpc of C57BL/6 mice (45%). We also now report expression of the AT<sub>2 </sub>receptor on nestin positive VM precursors. Our observation of abundance of the AT<sub>2 </sub>receptor on immature cells is corroborated by others, who have reported that during development AT<sub>2 </sub>receptor expression levels are high in the brain but significantly decrease during adulthood <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. More direct evidence for a role of the brain-RAS in PD comes from studies examining the neuroprotective effects of ACE inhibitors in 6-hydroxydopamine and MPTP-induced neurotoxicity rodent models <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. ACE inhibitors prevent the formation of Ang II from the decapeptide Ang I, which results in indiscriminate reduction in signaling at all AT receptors, including a potential beneficial AT<sub>2 </sub>effect. Our study demonstrates that similar neuroprotection can be obtained by selective antagonism of the AT<sub>1 </sub>receptor, in the absence of disruption of Ang II generation and its activity at other AT receptors. One possible mechanism for the neuroprotective effects resulting from inhibiting the AT<sub>1 </sub>receptor might relate to oxyradical generation. Activation of the AT<sub>1 </sub>receptor can lead to upregulation of NADPH oxidase, a mechanism for generation of superoxide and elevation of oxidative stress <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>.</p>
         <p>In addition, the AT<sub>1 </sub>receptor has been shown to induce an upregulation of TH, which may result in higher levels of DA <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>. Studies have suggested that elevated DA levels may lead to DA quinones, which can mediate oxidative stress. Additional processes that might contribute to susceptibility of DA neurons in PD include: (1) toxicity of tetrahydrobiopterin (an obligatory cofactor for TH) via increased DA production and the cofactor's autooxidation <abbrgrp><abbr bid="B52">52</abbr></abbrgrp> and (2) increasing catecholamine concentrations via overexpression of &#945;-synuclein and resulting disruption of vesicular pH that perturbs the ability of vesicles to store neurotransmitters <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. Others however argue that elevated DA actually inhibits formation of &#945;-synuclein aggregates <abbrgrp><abbr bid="B54">54</abbr></abbrgrp> and that depletion of DA <it>in vivo </it>does not protect from acute toxicity of MPTP <abbrgrp><abbr bid="B55">55</abbr></abbrgrp>. Taken together, these findings have to be interpreted in the context of variations in the models, neurotransmitter concentrations, and time scales, all of which affect the outcome. Nonetheless, most of these studies point to a likely central role for DA in the pathogenesis of PD.</p>
         <p>While it may be beneficial to prevent AT<sub>1 </sub>receptor signaling through the use of ACE inhibitors, the reduction of Ang II in the brain will also prevent the neuroprotective actions of AT<sub>2 </sub>receptor-mediated signaling. The beneficial attributes of the AT<sub>2 </sub>receptor can be seen in studies describing how the AT<sub>2 </sub>receptor counteracts the actions of the AT<sub>1 </sub>receptor by means of its downstream signaling cascades or provide neuroprotection against mitochondrial toxins when unopposed by the AT<sub>1 </sub>receptor through the use of specific receptor antagonists targeting the AT<sub>1 </sub>receptor <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B19">19</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp>. In addition, recent studies have also shown a relationship between metabolites of Ang II, such as angiotensin IV, which is believed to be the agonist for the AT<sub>4 </sub>receptor and is suggested to have a role in memory <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B44">44</abbr><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr><abbr bid="B47">47</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>In this study, we demonstrate that antagonism of the AT<sub>1 </sub>receptor can protect dopaminergic neurons from a neurotoxin based <it>in vivo </it>PD model. While we are actively investigating the role of the brain-RAS in PD, the angiotensin system may have a role in other neurodegenerative diseases such as Alzheimer's disease, multiple sclerosis, and Huntington's disease <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B48">48</abbr></abbrgrp>. Additional research will be needed to completely understand the roles of this system in the brain.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Ventral mesencephalic culture</p>
            </st>
            <p>Rat ventral mesencephalic (VM) tissues from E15 Sprague Dawley embryos were dissected into Ca<sup>+2</sup>/Mg<sup>+2 </sup>&#8211; free Hank's buffered salt solution (HBSS), mechanically dispersed and centrifuged <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. The cells were resuspended in F12 medium with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 &#956;g/ml streptomycin (Sigma). Viability was determined using trypan blue exclusion. Cells were seeded at a density of 6 &#215; 10<sup>4 </sup>viable cells/cm<sup>2 </sup>on polyethylenimine (1 &#956;g/ml) pre-coated 96- and 12-well culture plates or 8-chambered glass slides and incubated for 6 days at 5% CO<sub>2</sub>/37&#176;C. Half of the medium was changed every 3&#8211;4 days. After 6 days of growth, primary VM cultures consist of approximately 55% neurons, 45% type 1 astrocytes and &lt;1% other cell types, as determined by immunohistochemical analysis <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>. Dopaminergic (TH<sup>+</sup>) neurons represented 2&#8211;5% of total cells in VM cultures.</p>
         </sec>
         <sec>
            <st>
               <p>Ventral mesencephalic culture treatments</p>
            </st>
            <p>VM cultures were exposed to the parkinsonism-inducing neurotoxin 1-methyl-4-phenylpyridinium (MPP<sup>+</sup>) (1&#8211;100 &#956;M) (Sigma) for 48 hr at 37&#176;C and then processed for analysis. In Ang II-treated cultures, the octapeptide (1&#8211;100 nM) (Sigma) was added either 30 min prior or 15, 30 or 60 min after MPP<sup>+ </sup>treatment. In an effort to determine AT receptor subtype specificity, VM cultures were pretreated with 2-n-Butyl-4-chloro-5-hydroxy-methyl-1-[(2'-(1H)-tetrazol-5-yl)biph enyl-4-yl)methyl]imidazol potassium salt (DuP 753, losartan) (1 &#956;M) (AT<sub>1 </sub>receptor antagonist) (Du Pont/Merck, Wilmington, DE) or PD123319 (1 &#956;M) (AT<sub>2 </sub>receptor antagonist) (Sigma) or both, 15 min prior to the addition of Ang II <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. Cells were exposed to the treatment agents for the duration of the experiment. VM cultures were then washed with PBS and fixed by the addition of 4% paraformaldehyde until analyzed.</p>
         </sec>
         <sec>
            <st>
               <p>Animals and treatments</p>
            </st>
            <p>Eight-week-old male C57BL/6 mice (Charles River Laboratories, Wilmington, MA) were used. Mice (n = 4&#8211;5 per group) received subcutaneous (200 &#956;l) injections of 2-n-Butyl-4-chloro-5-hydroxy-methyl-1-[(2'-(1H)-tetrazol-5-yl)biphenyl-4-yl)methyl]imidazol potassium salt (DuP 753, losartan) (90 mg/kg) (100 mg tablets, Du Pont/Merck, Wilmington, DE; dissolved in saline and filtered through a 0.2 &#956;m filter) daily for 16 days, beginning two days prior to the first MPTP injection (Fig. <figr fid="F1">1</figr>). It is expected that the current dosing of losartan should result in greater than 60% inhibition of AT<sub>1 </sub>receptors in the brain <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. Control animals received saline injections. Losartan and saline control treated mice received four intraperitoneal injections of MPTP-hydrochloride (20 mg/kg of free base; Sigma) in saline at 2-hour intervals on day 3 followed by a single intraperitoneal injection of MPTP-hydrochloride (20 mg/kg) on day 9, and were sacrificed 7 days after the last MPTP injection <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. Control mice received saline injections. This protocol is in accordance with the NIH guidelines for use of live animals and was approved by the Institutional Animal Care and Use Committee of the University of Colorado at Denver and Health Sciences Center.</p>
         </sec>
         <sec>
            <st>
               <p>Immunohistochemical analysis</p>
            </st>
            <p>For immunohistochemical analysis, animals were perfused with 20 ml of saline followed by 20 ml of freshly made 4% paraformaldehyde. Brains were then removed and stored in 4% paraformaldehyde until analyzed. Fixed VM cultures or 40 &#956;m brain sections were incubated with an appropriate primary antibody overnight at 4&#176;C, followed by 1 hr incubation with a secondary antibody at room temperature. To identify DA neurons, a polyclonal (rabbit) anti-TH antibody (1:500) (Pel-Freez, Rogers, AR) was used. TH<sup>+ </sup>cells were visualized by nickel-enhanced DAB staining (Pierce) using a Vectastain kit (Vector laboratories, Burlingame, CA) or by immunofluorescence using an appropriate secondary antibody. Different cell types in the cultures were identified with a polyclonal (mouse) anti-glial fibrillary acidic protein (GFAP) (1:200) for astrocytes, a polyclonal (mouse) anti-nestin (1:400) for neural progenitors, and a polyclonal (mouse) anti-microtubule-associated protein 2 (MAP2) (1:200) or a polyclonal (mouse) anti-neuronal nuclear protein (NeuN) (1:200) for neuronal cell types (Chemicon, Temecula, CA). To determine AT receptor subtypes, a commercially available polyclonal (rabbit) anti-AT<sub>1 </sub>(N-10) (1:50) (Santa Cruz Biotechnology, Inc), polyclonal (goat) anti-AT<sub>2 </sub>(H-143) (1:50) (Santa Cruz Biotechnology, Inc), polyclonal anti-AT<sub>1</sub>(rabbit) (18801) (1:200) (Abcam), polyclonal (rabbit) anti-AT<sub>2 </sub>(C-18) (1:100) (Santa Cruz Biotechnology, Inc) or a polyclonal anti-AT<sub>2 </sub>(rabbit) (19134) (1:200) (Abcam) antibodies were used <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. Secondary antibodies used were Alexa 488-conjugated (donkey) anti-goat IgG (1:1000), Alexa 488-conjugated (donkey) anti-rabbit IgG (1:1000), Alexa 594-conjugated (donkey) anti-rabbit IgG (1:1000) and Alexa 594-conjugated (donkey) anti-mouse IgG (1:1000) (Molecular Probes, Eugene, OR). Total cells were visualized by Hoechst stained nuclei. Double and triple staining was done consecutively. Stained cultures were visualized by light and/or fluorescence microscopy using Zeiss or Nikon microscopes. For AT receptor profile counts <it>in vitro</it>, a total of 700 TH<sup>+ </sup>cells co-labeled for AT<sub>1 </sub>or AT<sub>2 </sub>receptor were counted from a minimum of 3 fields. For the <it>in vivo </it>AT receptor profile, TH<sup>+ </sup>cells co-labeled for AT<sub>1 </sub>or AT<sub>2 </sub>receptor were counted from the SNpc of 3 coronal sections. To determine the number of total cells in the SNpc, selected sections were defatted, rehydrated through descending alcohol concentrations, stained in cresyl violet acetate for 1 minute followed by acetic formalin, then dehydrated and cleared in xylene before coverslipping in Permount. Quantification of VM culture TH<sup>+ </sup>cells' survival was done by a blinded observer who counted all the positively stained cells having a distinct nucleus and visible neurites in the entire well. Each experimental condition <it>in vitro </it>represents 4&#8211;6 independent experiments.</p>
         </sec>
         <sec>
            <st>
               <p>Measurements of striatal MPP<sup>+ </sup>levels</p>
            </st>
            <p>HPLC with UV detection (wavelength = 295 nm) was used to measure striatal MPP<sup>+ </sup>levels <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. Mice were injected subcutaneously (n = 3) daily with losartan (90 mg/kg) or saline for 3 days. On day 3, mice were injected 4 times every 2 hours intraperitoneally with saline or MPTP-hydrochloride (20 mg/kg). Sixty minutes after the last MPTP injection mice were sacrificed and the brains were immediately removed. The substantia nigra (SN) and striatum were dissected out on ice and rapidly frozen on dry ice and stored at -80&#176;C until analysis. On the day of the assay, SN and striatum were prepared by sonicating the tissue samples in 9% (wt/vol) of 5% trichloroacetic acid (Sigma) containing 5 &#956;g/ml of 4-phenylpyridine (Sigma), as an internal standard. After centrifugation, 50 &#956;l of supernatant were injected onto a cation-exchange C18 column (Alltech). The mobile phase consisted of 89% (v/v) 50 mM KH<sub>2</sub>PO<sub>4 </sub>(pH 3 adjusted with H<sub>3</sub>PO<sub>4</sub>) and 11% (v/v) acetonitrile. The flow rate was 1.5 ml/min.</p>
         </sec>
         <sec>
            <st>
               <p>Dopamine uptake measurements</p>
            </st>
            <p>Dissociated mesencephalic neurons were grown as described above. The neurons were rinsed and then assayed at 37&#176;C in Krebs-Ringer HEPES buffer (KRH; 120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl<sub>2</sub>, 1.2 mM Mg SO<sub>4</sub>, 1.2 mM KH<sub>2</sub>PO<sub>4</sub>, 10 mM glucose, 10 mM HEPES, pH 7.4) supplemented with 10 &#956;M pargyline, 10 &#956;M ascorbic acid, and 10 &#956;M catechol. Assays (1 ml) included 100 nM [<sup>3</sup>H] DA. Nonspecific [<sup>3</sup>H] DA accumulation was determined in the presence of 1 mM (-) cocaine hydrochloride. After 10 min of incubation at 37&#176;C, uptake was terminated by quickly washing the neurons three times with 1 ml of ice-cold KRH. Neurons were then solubilized in 0.5 ml of 3% trichloroacetic acid for 60 min with gentle shaking. Accumulated [<sup>3</sup>H] DA was determined by liquid scintillation counting (n = 3) <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Animal blood pressure measurements</p>
            </st>
            <p>Losartan (0.18 mg/mL) was administered through the drinking water and tail artery blood pressures were recorded non-invasively from awake animals. Animals were placed in a restraining tube heated to 37&#176;C, and a pressure cuff and piezoelectric transducer were secured to the rostral base of the tail (PowerLab, AD Instruments). Animals were conditioned for ten to fifteen minutes by inflating the pressure cuff to 200 mmHg once every minute. Post-conditioning pulse and cuff pressure recordings were simultaneously acquired for up to 45 min at one reading per minute. Motion artifact detected by the pulse transducer during cuff deflation served as grounds for elimination of data points. Systolic and diastolic pressures were determined offline (Chart, AD Instruments). Systolic pressure was defined as cuff pressure upon first detection of pulse during deflation. Diastolic pressure was defined as cuff pressure when the pulse reading resumed normal amplitude (n = 4, >32 readings per animal).</p>
         </sec>
         <sec>
            <st>
               <p>Stereological analysis of TH<sup>+ </sup>neurons and Nissl-stained cells in the SNpc</p>
            </st>
            <p>Substantia nigra sections were immunostained for TH or stained with cresyl violet as described above. The SN in C57BL/6 mice measures approximately 1.7 mm in rostrocaudal extent. Based on a comparative mouse brain atlas <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>, the SN is completely contained between the coronal planes defined between -2.40 mm and -4.20 mm from bregma. A total of 54 (40 &#956;m) sections were cut on a cryostat and separated into three section pools using every third section per pool. The three section pools contained the entire SN. Due to tissue shrinkage the actual thickness of fixed and stained tissue was on average 21 &#956;m. TH-immunoreactive SNpc neurons were estimated using an unbiased stereological method according to the optical fractionator principle <abbrgrp><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr><abbr bid="B61">61</abbr></abbrgrp> using a Leica DMRB microscope with motorized stage running BioQuant Nova Prime Revision 3.0 (BioQuant Image Analysis Corporation, Nashville, TN) on a 75 &#956;m &#215; 75 &#956;m grid with a dissector size of 50 &#956;m &#215; 50 &#956;m. The contour outlines and landmarks of the SNpc, which comprise the A9 cell group, were drawn on an image captured with a 5&#215; objective. Using a 100&#215; objective and starting at the top of the section with the top plane of the cells in focus, the z-plane guards were determined by excluding 4 &#956;m from the surfaces and only the TH<sup>+ </sup>profiles that came into focus within the counting frame thickness (13 &#956;m) between the guard zones were counted. Care was taken to ensure that the top and bottom forbidden planes were not included in the analysis. Adjacent sections were stained with cresyl violet acetate and cells in the SNpc were counted in a similar manner as with the TH<sup>+ </sup>immunostained sections, with the exception that large nuclear Nissl stained cells were counted instead of TH<sup>+ </sup>cells. Because Nissl staining was done separately from TH immunostaining, it is possible that non-dopaminergic neurons and glia were also included in the total cell counts. Because of the careful demarcation of the SNpc (Fig. <figr fid="F7">7a</figr>), the majority of large nuclear Nissl stained cells in the selected area are likely to be neurons of the A9 cell group. All stereological counts were done blindly to the treatment conditions. A coefficient of error (CE) of &lt;0.02 was accepted (Table <tblr tid="T3">3</tblr>), for TH (n = 4&#8211;5 animals/group) and Nissl stained cells (n = 3 animals/group). Counts are represented as mean &#177; SEM.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>TH<sup>+ </sup>neuronal counts and coefficient of variance (CV) values for all animal groups.</p>
               </caption>
               <tblbdy cols="9">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Treatment</b>
                        </p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>Saline</b>
                        </p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>MPTP</b>
                        </p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>MPTP+Los</b>
                        </p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>Losartan</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>Animal</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Neurons</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>CV</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Neurons</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>CV</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Neurons</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>CV</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Neurons</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>CV</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>6749</p>
                     </c>
                     <c ca="center">
                        <p>0.08</p>
                     </c>
                     <c ca="center">
                        <p>3299</p>
                     </c>
                     <c ca="center">
                        <p>0.12</p>
                     </c>
                     <c ca="center">
                        <p>4028</p>
                     </c>
                     <c ca="center">
                        <p>0.09</p>
                     </c>
                     <c ca="center">
                        <p>3728</p>
                     </c>
                     <c ca="center">
                        <p>0.14</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>6138</p>
                     </c>
                     <c ca="center">
                        <p>0.06</p>
                     </c>
                     <c ca="center">
                        <p>2237</p>
                     </c>
                     <c ca="center">
                        <p>0.19</p>
                     </c>
                     <c ca="center">
                        <p>2837</p>
                     </c>
                     <c ca="center">
                        <p>0.06</p>
                     </c>
                     <c ca="center">
                        <p>5714</p>
                     </c>
                     <c ca="center">
                        <p>0.11</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>7389</p>
                     </c>
                     <c ca="center">
                        <p>0.09</p>
                     </c>
                     <c ca="center">
                        <p>2322</p>
                     </c>
                     <c ca="center">
                        <p>0.14</p>
                     </c>
                     <c ca="center">
                        <p>6144</p>
                     </c>
                     <c ca="center">
                        <p>0.10</p>
                     </c>
                     <c ca="center">
                        <p>7766</p>
                     </c>
                     <c ca="center">
                        <p>0.09</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>4591</p>
                     </c>
                     <c ca="center">
                        <p>0.07</p>
                     </c>
                     <c ca="center">
                        <p>1719</p>
                     </c>
                     <c ca="center">
                        <p>0.08</p>
                     </c>
                     <c ca="center">
                        <p>5762</p>
                     </c>
                     <c ca="center">
                        <p>0.07</p>
                     </c>
                     <c ca="center">
                        <p>5723</p>
                     </c>
                     <c ca="center">
                        <p>0.11</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>6446</p>
                     </c>
                     <c ca="center">
                        <p>0.08</p>
                     </c>
                     <c ca="center">
                        <p>2373</p>
                     </c>
                     <c ca="center">
                        <p>0.12</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Striatal TH<sup>+ </sup>staining densitometry</p>
            </st>
            <p>Striatal sections were stained for TH as described above. Digital images were taken of each striatal section (3 sections per animal counting both the left and right striatum, n = 4&#8211;5 animals/group) using a Nikon Eclipse 800 microscope and a CCD camera with Spot software. TH<sup>+ </sup>staining densities were then analyzed using Adobe Photoshop software. Cortical areas (background) densitometry readings were subtracted from the measured densitometry of striatal areas. Measurements are represented as percent of control densities from saline-treated animals and are represented as mean &#177; SEM. Densitometric quantification of striatal TH<sup>+ </sup>staining was done by a blinded observer.</p>
         </sec>
         <sec>
            <st>
               <p>Laser capture microdissection (LCM)</p>
            </st>
            <p>Twelve-week-old male C57BL/6 mice were euthanized using CO<sub>2 </sub>asphyxiation. The brains were removed and immediately frozen in isopentane on dry ice. Brains were then stored at -80&#176;C until analysis. Brains were then cut on a cryostat and 10 &#956;m coronal sections were mounted on uncoated slides and stored at -80&#176;C. Slides were allowed to briefly reach room temperature and were stained for TH using a rapid staining protocol to minimize mRNA degradation. Briefly, slides were fixed in acetone (40 seconds), washed briefly 3 times in phosphate buffer (PB; pH = 7.4), followed by a 5 min incubation with a mouse-anti-TH antibody (Sigma, 1:1000) diluted in PB. Slides were washed 3 times with PB, followed by 5 minute incubation with a Cy3-conjugated goat anti-mouse IgG (Jackson Labs, 1:500) diluted in PB. Slides were washed twice in PB and then dehydrated in ethanol (50%, 70%, 95%, and 100%), (10 seconds each) and delipidated in xylene (40 seconds). Slides were then allowed to air dry. All procedures were carried out in an RNAse-free environment.</p>
            <p>Tyrosine hydroxylase positive cells of the SNpc and VTA were visualized and dissected using a PixCell laser capture microscope under a 20&#215; objective with an infrared diode laser (Arcturus Engineering, Santa Clara, CA). Approximately 500 TH positive cells per animal from the SNpc or VTA we isolated on a single LCM HS cap (Arcturuss Arcturus Engineering, Santa Clara, CA). RNAs were isolated using a PicoPure RNA Isolation kit (Arcturus, Mountain View, CA, USA) according to manufacturer's guidelines, and subjected to DNAse treatment (Qiagen, Valencia, CA, USA).</p>
         </sec>
         <sec>
            <st>
               <p>Real-time RT-PCR</p>
            </st>
            <p>Atgr2, TH and GAPDH mRNA expression profiles were done by quantitative real-time PCR on TH<sup>+ </sup>neurons from the SNpc or VTA. Primers used are listed in table <tblr tid="T4">4</tblr>. The primers (18&#8211;22 mer) were designed using Primer3 <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>. These primer sets were designed to amplify small amplicons for candidate mRNAs ranging from 100&#8211;300 bp in size. First-strand cDNA synthesis was carried out on mRNA extracted with SuperscriptTM first-strand synthesis kit (Invitrogen Carlsbad, CA) according to the manufacturer's specifications. Real-time RT-PCR was carried out in a 96 well plate using a MyiQ iCycler (BioRad, Hercules, CA), and SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). A concentration curve with known concentrations of whole brain cDNA extracts from 12-week-old male C57BL/6 mice was used to calculate standard curves and quantitate the products. The final concentration of each transcript was calculated using the MyiQ2.0 software provided by BioRad.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>List of primers used for Real Time RT-PCR.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Atgr2</p>
                     </c>
                     <c ca="left">
                        <p>accaatcggtcatctaccctt</p>
                     </c>
                     <c ca="left">
                        <p>left</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ggcaatgaggatagacaagcc</p>
                     </c>
                     <c ca="left">
                        <p>right</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>GAPDH</p>
                     </c>
                     <c ca="left">
                        <p>tggtgaagcaggcatctgag</p>
                     </c>
                     <c ca="left">
                        <p>left</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>tgctgttgaagtcgcaggag</p>
                     </c>
                     <c ca="left">
                        <p>right</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TH</p>
                     </c>
                     <c ca="left">
                        <p>ttctgaaggaacggactgg</p>
                     </c>
                     <c ca="left">
                        <p>left</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ggcatgacggatgactgtg</p>
                     </c>
                     <c ca="left">
                        <p>right</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Western immunoblot analysis</p>
            </st>
            <p>The expression of AT<sub>1 </sub>and AT<sub>2 </sub>receptors was examined in an immortalized mesencephalic dopaminergic cell line, N27 <abbrgrp><abbr bid="B63">63</abbr></abbrgrp>. N27 cells were thawed into RPMI 1640 media containing 10% FBS, 2 mM glutamine, 100 U/ml penicillin and 100 &#956;g/ml streptomycin. Cells were collected in lysis buffer (Cell Signaling Technology, Beverly, MA) with 1% SDS. After sonication, the lysate was centrifuged at 10,000 &#215; g for 45 min at 4&#176;C, and the proteins in the supernatant were separated on 4&#8211;12% Bis-Tris polyacrylamide gel. After transfer to PVDF membranes, the proteins were probed for AT<sub>1 </sub>receptors (Santa Cruz polyclonal sc-1173 or Abcam polyclonal ab 18801, 1:500 dilution), AT<sub>2 </sub>receptors (Santa Cruz polyclonal sc-9040 or Abcam polyclonal ab 19134, 1:500 dilution). Secondary, alkaline phosphatase-conjugated anti-rabbit (1:5000; Sigma) and anti-mouse (1:10,000, Jackson ImmunoResearch) antibodies were followed by Lumi-Phos (Pierce) for chemiluminescence detection. Blots were stripped and reprobed for &#946;-actin (Sigma, 1:10,000) to confirm equal protein loading on the gel.</p>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>Data were analyzed using Statistica software. Statistical significance was determined by one-way ANOVA followed by post-hoc Newman-Keuls multiple comparison tests. Differences in mean values were considered significant at p &#8804; 0.05. All data were obtained from at least three independent experiments and are represented as a mean &#177; SEM.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>ACE, angiotensin converting enzyme; Ang II, angiotensin II; ANOVA, analysis of variance; AT<sub>1 </sub>receptor, Ang II type 1 receptor; Agtr2, gene encoding AT<sub>2 </sub>receptor; BP, blood pressure; CE, coefficient of error; CV, coefficient of variance; DA, dopamine or dopaminergic; DAT, dopamine transporter; E15, embryonic day 15; GDNF, glial cell line-derived neurotrophic factor; GFAP, glial fibrillary acidic protein; GPCR, G-protein coupled receptor; HBSS, Hank's buffered salt solution; LCM, laser capture microdissection; MANF, mesencephalic astrocytes-derived neurotrophic factor; MAP2, microtubule-associated protein 2; MPTP, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; MPP+, 1-methyl-4-phenylpyridinium; NeuN, neuronal nuclear protein; NIH, National Institutes of Health; PD, Parkinson's disease; PKC, protein kinase C; PLA2, phospholipase 2; RAS, renin-angiotensin-system; RT-PCR, reverse transcriptase polymerase chain reaction; SNpc, substantia nigra pars compacta; TH, tyrosine hydroxylase; VM, ventral mesencephalon; VTA, ventral tagmental area.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>All authors read and approved the final manuscript. TNG, WMZ and JAW designed the research. TNG and WMZ wrote the paper. TNG, SMJ, FAA, BRH, LDS, AMP, JS and VVJ performed the research.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>Supported by the NIH Training Grant (T32 AA07464), Integrated Neuroscience Initiative on Alcoholism (INIA) AA13473, and Minority Summer Alcohol Research Program sponsored by the Department of Pharmacology. We thank Dr. Curt Freed for his comments on the manuscript and Cindy Hutt for her technical assistance. The authors are also indebted to Dr. Boris Tabakoff, Dr. Nancy Zahniser, Dr. Joe Gal, Dr. John Gerber, Dr. James West and Dr. David Standaert for use of their equipment.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>An essay on the shaking palsy</p>
            </title>
            <aug>
               <au>
                  <snm>Parkinson</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <publisher>London: printed by Whittingham and Rowland for Sherwood</publisher>
            <editor>Neely, Jones</editor>
            <pubdate>1817</pubdate>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Dopamine (3-hydroxytyramine) and brain function</p>
            </title>
            <aug>
               <au>
                  <snm>Hornykiewicz</snm>
                  <fnm>O</fnm>
               </au>
            </aug>
            <source>Pharmacol Rev</source>
            <pubdate>1966</pubdate>
            <volume>18</volume>
            <fpage>925</fpage>
            <lpage>64</lpage>
            <xrefbib>
               <pubid idtype="pmpid">5328389</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Parkinson's disease: mechanisms and models</p>
            </title>
            <aug>
               <au>
                  <snm>Dauer</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Przedborski</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Neuron</source>
            <pubdate>2003</pubdate>
            <volume>39</volume>
            <fpage>889</fpage>
            <lpage>909</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0896-6273(03)00568-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">12971891</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Parkinson's disease risk factors: genetic, environmental, or both?</p>
            </title>
            <aug>
               <au>
                  <snm>Allam</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Castillo</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Navajas</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>Neurol Res</source>
            <pubdate>2005</pubdate>
            <volume>27</volume>
            <fpage>206</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1179/016164105X22057</pubid>
                  <pubid idtype="pmpid" link="fulltext">15829184</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Systematic review of incidence studies of Parkinson's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Twelves</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Perkins</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Counsell</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Mov Disord</source>
            <pubdate>2003</pubdate>
            <volume>18</volume>
            <fpage>19</fpage>
            <lpage>31</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/mds.10305</pubid>
                  <pubid idtype="pmpid" link="fulltext">12518297</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>The 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model: a tool to explore the pathogenesis of Parkinson's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Przedborski</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Vila</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Ann NY Acad Sci</source>
            <pubdate>2003</pubdate>
            <volume>991</volume>
            <fpage>189</fpage>
            <lpage>98</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12846987</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Pathophysiology of Parkinson's disease: the MPTP primate model of the human disorder</p>
            </title>
            <aug>
               <au>
                  <snm>Wichmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>DeLong</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>Ann NY Acad Sci</source>
            <pubdate>2003</pubdate>
            <volume>991</volume>
            <fpage>199</fpage>
            <lpage>213</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12846988</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Chronic systemic pesticide exposure reproduces features of Parkinson's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Betarbet</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sherer</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>MacKenzie</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Garcia-Osuna</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Panov</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Greenamyre</snm>
                  <fnm>JT</fnm>
               </au>
            </aug>
            <source>Nat Neurosci</source>
            <pubdate>2000</pubdate>
            <volume>3</volume>
            <fpage>1301</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/81834</pubid>
                  <pubid idtype="pmpid" link="fulltext">11100151</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Molecular pathways of neurodegeneration in Parkinson's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Dawson</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Dawson</snm>
                  <fnm>VL</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2003</pubdate>
            <volume>302</volume>
            <fpage>819</fpage>
            <lpage>22</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1087753</pubid>
                  <pubid idtype="pmpid" link="fulltext">14593166</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Neuroprotective therapy in Parkinson's disease and motor complications: A search for a pathogenesis-targeted, disease-modifying strategy</p>
            </title>
            <aug>
               <au>
                  <snm>Olanow</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Jankovic</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mov Disord</source>
            <pubdate>2005</pubdate>
            <volume>20</volume>
            <issue>Suppl 11</issue>
            <fpage>S13</fpage>
            <lpage>S10</lpage>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Functions of angiotensin in the central nervous system</p>
            </title>
            <aug>
               <au>
                  <snm>Phillips</snm>
                  <fnm>MI</fnm>
               </au>
            </aug>
            <source>Annu Rev Physiol</source>
            <pubdate>1987</pubdate>
            <volume>49</volume>
            <fpage>413</fpage>
            <lpage>35</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.ph.49.030187.002213</pubid>
                  <pubid idtype="pmpid" link="fulltext">3551809</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Brain angiotensin receptor subtypes in the control of physiological and behavioral responses</p>
            </title>
            <aug>
               <au>
                  <snm>Wright</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Harding</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Neurosci Biobehav Rev</source>
            <pubdate>1994</pubdate>
            <volume>18</volume>
            <fpage>21</fpage>
            <lpage>53</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0149-7634(94)90034-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">8170622</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>The brain renin-angiotensin system: molecular mechanisms of cell to cell interactions</p>
            </title>
            <aug>
               <au>
                  <snm>Lippoldt</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Paul</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fuxe</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ganten</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Clin Exp Hypertens</source>
            <pubdate>1995</pubdate>
            <volume>17</volume>
            <fpage>251</fpage>
            <lpage>66</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7735273</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Levels of angiotensin and molecular biology of the tissue renin angiotensin systems</p>
            </title>
            <aug>
               <au>
                  <snm>Phillips</snm>
                  <fnm>MI</fnm>
               </au>
               <au>
                  <snm>Speakman</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Kimura</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Regul Pept</source>
            <pubdate>1993</pubdate>
            <volume>22</volume>
            <fpage>1</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/0167-0115(93)90403-U</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>International union of pharmacology XXIII. The angiotensin II receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Gasparo</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Catt</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Inagami</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>TH</fnm>
               </au>
            </aug>
            <source>Pharmacol Rev</source>
            <pubdate>2000</pubdate>
            <volume>52</volume>
            <fpage>415</fpage>
            <lpage>472</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10977869</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Cross-talk between angiotensin II receptors and the tyrosine kinases and phosphatases</p>
            </title>
            <aug>
               <au>
                  <snm>Inagami</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Eguchi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Numaguchi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Motley</snm>
                  <fnm>ED</fnm>
               </au>
               <au>
                  <snm>Tang</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Matsumoto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Yamakawa</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Am Soc Nephrol</source>
            <pubdate>1999</pubdate>
            <volume>11</volume>
            <fpage>S57</fpage>
            <lpage>61</lpage>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Serum angiotensin-converting enzyme in multiple sclerosis</p>
            </title>
            <aug>
               <au>
                  <snm>Constantinescu</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Goodman</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Grossman</snm>
                  <fnm>RI</fnm>
               </au>
               <au>
                  <snm>Mannon</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Arch Neurol</source>
            <pubdate>1997</pubdate>
            <volume>54</volume>
            <fpage>1012</fpage>
            <lpage>5</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9267976</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Alterations in angiotensin AT1 and AT2 receptor subtype levels in brain regions from patients with neurodegenerative disorders</p>
            </title>
            <aug>
               <au>
                  <snm>Ge</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Barnes</snm>
                  <fnm>NM</fnm>
               </au>
            </aug>
            <source>Eur J Pharmacol</source>
            <pubdate>1996</pubdate>
            <volume>297</volume>
            <fpage>299</fpage>
            <lpage>306</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0014-2999(95)00762-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">8666063</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Angiotensin protects cortical neurons from hypoxic-induced apoptosis via the angiotensin type 2 receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Grammatopoulos</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ferguson</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Weyhenmeyer</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Brain Res Mol Brain Res</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>114</fpage>
            <lpage>24</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0169-328X(02)00101-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">11978402</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Angiotensin II protects cultures midbrain dopaminergic neurons against rotenone-induced cell death</p>
            </title>
            <aug>
               <au>
                  <snm>Grammatopoulos</snm>
                  <fnm>TN</fnm>
               </au>
               <au>
                  <snm>Ahmadi</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Rariss</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Weyhenmeyer</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Zawada</snm>
                  <fnm>WM</fnm>
               </au>
            </aug>
            <source>Brain Res</source>
            <pubdate>2005</pubdate>
            <volume>1045</volume>
            <fpage>64</fpage>
            <lpage>71</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15910763</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Are Angiotensin receptor blockers neuroprotective?</p>
            </title>
            <aug>
               <au>
                  <snm>Thone-Reineke</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Zimmermann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Neumann</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Krikov</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gerova</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Curr Hypertens Rep</source>
            <pubdate>2004</pubdate>
            <volume>6</volume>
            <fpage>257</fpage>
            <lpage>66</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15257859</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Inhibiting renin-angiotensin in the brain: the possible therapeutic implications</p>
            </title>
            <aug>
               <au>
                  <snm>Unger</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Blood Press</source>
            <pubdate>2001</pubdate>
            <volume>1</volume>
            <fpage>12</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1080/080370501750066453</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Genetic analysis of vascular factors in Alzheimer's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Wakutani</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kowa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kusumi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yamagata</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Wada-Isoe</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Adachi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Takeshima</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Urakami</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nakashima</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Ann NY Acad Sci</source>
            <pubdate>2002</pubdate>
            <volume>977</volume>
            <fpage>232</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12480755</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>The brain angiotensin system and extracellular matrix molecules in neural plasticity, learning, and memory</p>
            </title>
            <aug>
               <au>
                  <snm>Wright</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Harding</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Prog Neurobiol</source>
            <pubdate>2004</pubdate>
            <volume>72</volume>
            <fpage>263</fpage>
            <lpage>93</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.pneurobio.2004.03.003</pubid>
                  <pubid idtype="pmpid" link="fulltext">15142685</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Association between genetic polymorphism of angiotensin-converting enzyme gene and Parkinson's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Yueh</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>SZ</fnm>
               </au>
            </aug>
            <source>J Neurol Sci</source>
            <pubdate>2002</pubdate>
            <volume>199</volume>
            <fpage>25</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0022-510X(02)00081-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">12084438</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Angiotensin II AT1 and AT2 receptor types regulate basal and stress-induced adrenomedullary catecholamine production through transcriptional regulation of tyrosine hydroxylase</p>
            </title>
            <aug>
               <au>
                  <snm>Armando</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Jezova</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bregonzio</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Baiardi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Saavedra</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Ann NY Acad Sci</source>
            <pubdate>2004</pubdate>
            <volume>1018</volume>
            <fpage>302</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1196/annals.1296.036</pubid>
                  <pubid idtype="pmpid" link="fulltext">15240382</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Angiotensin II AT-1A receptor immunolabeling in rat medial nucleus tractus solitarius neurons: subcellular targeting and relationships with catecholamines</p>
            </title>
            <aug>
               <au>
                  <snm>Glass</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Speth</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Iadecola</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pickel</snm>
                  <fnm>VM</fnm>
               </au>
            </aug>
            <source>Neuroscience</source>
            <pubdate>2005</pubdate>
            <volume>130</volume>
            <fpage>713</fpage>
            <lpage>23</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.neuroscience.2004.08.057</pubid>
                  <pubid idtype="pmpid" link="fulltext">15590154</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Angiotensin II regulates tyrosine hydroxylase activity and mRNA expression in rat mediobasal hypothalamic cultures: the role of specific protein kinases</p>
            </title>
            <aug>
               <au>
                  <snm>Ma</snm>
                  <fnm>FY</fnm>
               </au>
               <au>
                  <snm>Grattan</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Bobrovskaya</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Dunkley</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Bunn</snm>
                  <fnm>SJ</fnm>
               </au>
            </aug>
            <source>J Neurochem</source>
            <pubdate>2004</pubdate>
            <volume>90</volume>
            <fpage>431</fpage>
            <lpage>41</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1471-4159.2004.02492.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15228599</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Delayed maturation of catecholamine phenotype in nucleus tractus solitarius of rats with glial angiotensinogen depletion</p>
            </title>
            <aug>
               <au>
                  <snm>Ogier</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bezin</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Cottet-Emard</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Bader</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vincent</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pequignot</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>McGregor</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bricca</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Hypertension</source>
            <pubdate>2003</pubdate>
            <volume>42</volume>
            <fpage>978</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1161/01.HYP.0000094982.97568.65</pubid>
                  <pubid idtype="pmpid" link="fulltext">14517224</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Angiotensin II-induced nuclear targeting of the angiotensin type 1 (AT1) receptor in brain neurons</p>
            </title>
            <aug>
               <au>
                  <snm>Lu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Shaw</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Raizada</snm>
                  <fnm>MK</fnm>
               </au>
            </aug>
            <source>endocrinology</source>
            <pubdate>1998</pubdate>
            <volume>139</volume>
            <fpage>365</fpage>
            <lpage>75</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1210/en.139.1.365</pubid>
                  <pubid idtype="pmpid" link="fulltext">9421435</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Angiotensin II increases differentiation of dopaminergic neurons from mesencephalic precursors via angiotensin type 2 receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Rodriguez-Pallares</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Quiroz</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Parga</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Guerra</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Labandeira-Garcia</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>Eur J Neurosci</source>
            <pubdate>2004</pubdate>
            <volume>20</volume>
            <fpage>1489</fpage>
            <lpage>98</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1460-9568.2004.03621.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15355316</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Effect of chronic angiotensin-converting enzyme inhibition on striatal dopamine content in the MPTP-treated mouse</p>
            </title>
            <aug>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>JY</fnm>
               </au>
               <au>
                  <snm>Howells</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Mendelsohn</snm>
                  <fnm>FA</fnm>
               </au>
               <au>
                  <snm>Chai</snm>
                  <fnm>SY</fnm>
               </au>
            </aug>
            <source>J Neurochem</source>
            <pubdate>1999</pubdate>
            <volume>73</volume>
            <fpage>214</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1471-4159.1999.0730214.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10386973</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Effect of angiotensin-converting enzyme inhibitor perindopril on interneurons in MPTP-treated mice</p>
            </title>
            <aug>
               <au>
                  <snm>Kurosaki</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Muramatsu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kato</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Imai</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Itoyama</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Araki</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Eur Neuropsychopharmacol</source>
            <pubdate>2005</pubdate>
            <volume>15</volume>
            <fpage>57</fpage>
            <lpage>67</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.euroneuro.2004.05.007</pubid>
                  <pubid idtype="pmpid" link="fulltext">15572274</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Neuroprotective effect of the angiotensin-converting enzyme inhibitor perindopril in MPTP-treated mice</p>
            </title>
            <aug>
               <au>
                  <snm>Kurosaki</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Muramatsu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Imai</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kato</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Araki</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Neurol Res</source>
            <pubdate>2004</pubdate>
            <volume>26</volume>
            <fpage>644</fpage>
            <lpage>57</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1179/016164104225015949</pubid>
                  <pubid idtype="pmpid" link="fulltext">15327754</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Angiotensin-converting enzyme inhibition reduces oxidative stress and protects dopaminergic neurons in a 6-hydroxydopamine rat model of parkinsonism</p>
            </title>
            <aug>
               <au>
                  <snm>Lopez-Real</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rey</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Soto-Otero</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mendez-Alvarez</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Labandeira-Garcia</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>J Neurosci Res</source>
            <pubdate>2005</pubdate>
            <volume>81</volume>
            <fpage>865</fpage>
            <lpage>873</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/jnr.20598</pubid>
                  <pubid idtype="pmpid" link="fulltext">16015598</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Chronic pretreatment with candesartan improves recovery from focal cerebral ischaemia in rats</p>
            </title>
            <aug>
               <au>
                  <snm>Groth</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Blume</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gohlke</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Culman</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Hypertens</source>
            <pubdate>2003</pubdate>
            <volume>21</volume>
            <fpage>2175</fpage>
            <lpage>82</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00004872-200311000-00028</pubid>
                  <pubid idtype="pmpid" link="fulltext">14597862</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Sustained blockade of brain AT1 receptors before and after focal cerebral ischemia alleviates neurologic deficits and reduces neuronal injury, poptosis, and inflammatory responses in the rat</p>
            </title>
            <aug>
               <au>
                  <snm>Lou</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Blume</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Gohlke</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Deuschl</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Herdegen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Culman</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Cereb Blood Flow Metab</source>
            <pubdate>2004</pubdate>
            <volume>24</volume>
            <fpage>536</fpage>
            <lpage>47</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00004647-200405000-00008</pubid>
                  <pubid idtype="pmpid">15129186</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Angiotensin II attenuates chemical hypoxia-induced caspase-3 activation in primary cortical neuronal cultures</p>
            </title>
            <aug>
               <au>
                  <snm>Grammatopoulos</snm>
                  <fnm>TN</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bachar</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Andres</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Weyhenmeyer</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Brain Res Bull</source>
            <pubdate>2004</pubdate>
            <volume>62</volume>
            <fpage>297</fpage>
            <lpage>303</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.brainresbull.2003.09.018</pubid>
                  <pubid idtype="pmpid" link="fulltext">14709344</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Angiotensin type 2 receptor neuroprotection against chemical hypoxia is dependent on the delayed rectifier K+ channel, Na+/Ca2+ exchanger and Na+/K+ ATPase in primary cortical cultures</p>
            </title>
            <aug>
               <au>
                  <snm>Grammatopoulos</snm>
                  <fnm>TN</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Andres</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Weyhenmeyer</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Neurosci Res</source>
            <pubdate>2004</pubdate>
            <volume>50</volume>
            <fpage>299</fpage>
            <lpage>306</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.neures.2004.07.010</pubid>
                  <pubid idtype="pmpid" link="fulltext">15488293</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Increase by FK960, a novel cognitive enhancer, in glial cell line-derived neurotrophic factor production in cultured rat astrocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Koyama</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Egawa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Osakada</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Baba</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Matsuda</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>2004</pubdate>
            <volume>68</volume>
            <fpage>275</fpage>
            <lpage>82</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bcp.2004.03.023</pubid>
                  <pubid idtype="pmpid" link="fulltext">15193999</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>MANF: a new mesencephalic, astrocyte-derived neurotrophic factor with selectivity for dopaminergic neurons</p>
            </title>
            <aug>
               <au>
                  <snm>Petrova</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Raibekas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pevsner</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Vigo</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Anafi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Peaire</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Shridhar</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>DI</fnm>
               </au>
               <au>
                  <snm>Kelly</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Durocher</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Commissiong</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>J Mol Neurosci</source>
            <pubdate>2003</pubdate>
            <volume>20</volume>
            <fpage>173</fpage>
            <lpage>88</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1385/JMN:20:2:173</pubid>
                  <pubid idtype="pmpid" link="fulltext">12794311</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Angiotensin receptors in the brain</p>
            </title>
            <aug>
               <au>
                  <snm>Hohle</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Blume</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lebrun</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Culman</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Pharmacol Toxicol</source>
            <pubdate>1995</pubdate>
            <volume>77</volume>
            <fpage>306</fpage>
            <lpage>15</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8778741</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>NADPH oxidase contributes to angiotensin II signaling in the nucleus tractus solitarius</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Anrather</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Speth</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Pickel</snm>
                  <fnm>VM</fnm>
               </au>
               <au>
                  <snm>Iadecola</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2004</pubdate>
            <volume>24</volume>
            <fpage>5516</fpage>
            <lpage>24</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.1176-04.2004</pubid>
                  <pubid idtype="pmpid" link="fulltext">15201324</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>AT4 receptor activation increases intracellular calcium influx and induces a non-N-methyl-D-aspartate dependent form of long-term potentiation</p>
            </title>
            <aug>
               <au>
                  <snm>Davis</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Kramar</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>De</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Meighan</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Simasko</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Harding</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Neuroscience</source>
            <pubdate>2006</pubdate>
            <volume>137</volume>
            <fpage>1369</fpage>
            <lpage>79</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.neuroscience.2005.10.051</pubid>
                  <pubid idtype="pmpid" link="fulltext">16343778</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>The angiotensin IV/AT4 receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Chai</snm>
                  <fnm>SY</fnm>
               </au>
               <au>
                  <snm>Fernando</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Peck</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ye</snm>
                  <fnm>SY</fnm>
               </au>
               <au>
                  <snm>Mendelsohn</snm>
                  <fnm>FA</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Albiston</snm>
                  <fnm>AL</fnm>
               </au>
            </aug>
            <source>Cell Mol Life Sci</source>
            <pubdate>2004</pubdate>
            <volume>61</volume>
            <fpage>2728</fpage>
            <lpage>37</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00018-004-4246-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">15549174</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>A role for the angiotensin AT4 receptor subtype in overcoming scopolamine-induced spatial memory deficits</p>
            </title>
            <aug>
               <au>
                  <snm>Pederson</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Krishnan</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Harding</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Regul Pept</source>
            <pubdate>2001</pubdate>
            <volume>102</volume>
            <fpage>147</fpage>
            <lpage>56</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0167-0115(01)00312-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">11730987</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Contributions of the brain angiotensin IV-AT4 receptor subtype system to spatial learning</p>
            </title>
            <aug>
               <au>
                  <snm>Wright</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Stubley</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Pederson</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Kramar</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Hanesworth</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Harding</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>1999</pubdate>
            <volume>19</volume>
            <fpage>3952</fpage>
            <lpage>61</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10234025</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Amyloid beta-protein is degraded by cellular angiotensin-converting enzyme (ACE) and elevated by an ACE inhibitor</p>
            </title>
            <aug>
               <au>
                  <snm>Hemming</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Selkoe</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2005</pubdate>
            <volume>280</volume>
            <fpage>37644</fpage>
            <lpage>50</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M508460200</pubid>
                  <pubid idtype="pmpid" link="fulltext">16154999</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Neural transplantation methods</p>
            </title>
            <aug>
               <au>
                  <snm>Dunnett</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Boulton</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>GB</fnm>
               </au>
            </aug>
            <source>neuromethods</source>
            <publisher>Humana Press, Totowa, NJ</publisher>
            <pubdate>2000</pubdate>
            <volume>36</volume>
            <fpage>3</fpage>
            <lpage>25</lpage>
         </bibl>
         <bibl id="B50">
            <title>
               <p>The pesticide rotenone induces caspase-3-mediated apoptosis in ventral mesencephalic dopaminergic neurons</p>
            </title>
            <aug>
               <au>
                  <snm>Ahmadi</snm>
                  <fnm>FA</fnm>
               </au>
               <au>
                  <snm>Linseman</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Grammatopoulos</snm>
                  <fnm>TN</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Bouchard</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Freed</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Heidenreich</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Zawada</snm>
                  <fnm>WM</fnm>
               </au>
            </aug>
            <source>J Neurochem</source>
            <pubdate>2003</pubdate>
            <volume>87</volume>
            <fpage>914</fpage>
            <lpage>21</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1471-4159.2003.02068.x</pubid>
                  <pubid idtype="pmpid">14622122</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Central nervous system blockade by peripheral administration of AT1 receptor blockers</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Tan</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Leenen</snm>
                  <fnm>FH</fnm>
               </au>
            </aug>
            <source>J Cardiovasc Pharmacol</source>
            <pubdate>2003</pubdate>
            <volume>41</volume>
            <fpage>593</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00005344-200304000-00012</pubid>
                  <pubid idtype="pmpid" link="fulltext">12658061</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Particular vulnerability of rat mesencephalic dopaminergic neurons to tetrahydrobiopterin: Relevance to Parkinson's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>SY</fnm>
               </au>
               <au>
                  <snm>Moon</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hee Choi</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Jin Choi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hwang</snm>
                  <fnm>O</fnm>
               </au>
            </aug>
            <source>Neurobiol Dis</source>
            <pubdate>2007</pubdate>
            <volume>25</volume>
            <fpage>112</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.nbd.2006.08.024</pubid>
                  <pubid idtype="pmpid" link="fulltext">17049260</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Alpha-synuclein overexpression increases cytosolic catecholamine concentration</p>
            </title>
            <aug>
               <au>
                  <snm>Mosharov</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Staal</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Bove</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Prou</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hananiya</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Markov</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Poulsen</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Larsen</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Troyer</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Edwards</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Przedborski</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sulzer</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2006</pubdate>
            <volume>26</volume>
            <fpage>9304</fpage>
            <lpage>11</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.0519-06.2006</pubid>
                  <pubid idtype="pmpid" link="fulltext">16957086</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Cytosolic catechols inhibit alpha-synuclein aggregation and facilitate the formation of intracellular soluble oligomeric intermediates</p>
            </title>
            <aug>
               <au>
                  <snm>Mazzulli</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Mishizen</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Giasson</snm>
                  <fnm>BI</fnm>
               </au>
               <au>
                  <snm>Lynch</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Nakashima</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nagatsu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ota</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ischiropoulos</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2006</pubdate>
            <volume>26</volume>
            <fpage>10068</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.0896-06.2006</pubid>
                  <pubid idtype="pmpid">17005870</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Dopamine depletion does not protect against acute 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine toxicity in vivo</p>
            </title>
            <aug>
               <au>
                  <snm>Hasbani</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Perez</snm>
                  <fnm>FA</fnm>
               </au>
               <au>
                  <snm>Palmiter</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>O'Malley</snm>
                  <fnm>KL</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2005</pubdate>
            <volume>25</volume>
            <fpage>9428</fpage>
            <lpage>33</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.0130-05.2005</pubid>
                  <pubid idtype="pmpid" link="fulltext">16221852</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Role of neuronal nitric oxide in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced dopaminergic neurotoxicity</p>
            </title>
            <aug>
               <au>
                  <snm>Przedborski</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jackson-Lewis</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Yokoyama</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Shibata</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Dawson</snm>
                  <fnm>VL</fnm>
               </au>
               <au>
                  <snm>Dawson</snm>
                  <fnm>TM</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1996</pubdate>
            <volume>93</volume>
            <fpage>4565</fpage>
            <lpage>71</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">39317</pubid>
                  <pubid idtype="pmpid" link="fulltext">8643444</pubid>
                  <pubid idtype="doi">10.1073/pnas.93.10.4565</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Locomotor activity induced by noncompetitive NMDA receptor antagonists versus dopamine transporter inhibitors: opposite strain differences in inbred long-sleep and short-sleep mice</p>
            </title>
            <aug>
               <au>
                  <snm>Hanania</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Zahniser</snm>
                  <fnm>NR</fnm>
               </au>
            </aug>
            <source>Alcohol Clin Exp Res</source>
            <pubdate>2002</pubdate>
            <volume>26</volume>
            <fpage>431</fpage>
            <lpage>40</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1530-0277.2002.tb02558.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11981117</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Comparative cytoarchitectonic atlas of the C57BL/6 and 129/Sv mouse brains</p>
            </title>
            <aug>
               <au>
                  <snm>Hof</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Warren</snm>
                  <fnm>YG</fnm>
               </au>
               <au>
                  <snm>Bloom</snm>
                  <fnm>FE</fnm>
               </au>
               <au>
                  <snm>Belichenko</snm>
                  <fnm>PV</fnm>
               </au>
               <au>
                  <snm>Celio</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <publisher>Elsevier, Amsterdam, The Netherlands</publisher>
            <pubdate>2000</pubdate>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Stereology of arbitrary particles. A review of unbiased number and size estimators and the presentation of some new ones, in memory of William R. Thompson</p>
            </title>
            <aug>
               <au>
                  <snm>Gundersen</snm>
                  <fnm>HJG</fnm>
               </au>
            </aug>
            <source>J Microsc</source>
            <pubdate>1986</pubdate>
            <volume>143</volume>
            <fpage>3</fpage>
            <lpage>45</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3761363</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Unbiased stereological estimation of the total number of neurons in the subdivisions of the rat hippocampus using the optical fractionator</p>
            </title>
            <aug>
               <au>
                  <snm>West</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Slomianka</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Gundersen</snm>
                  <fnm>HJG</fnm>
               </au>
            </aug>
            <source>Anat Rec</source>
            <pubdate>1991</pubdate>
            <volume>231</volume>
            <fpage>482</fpage>
            <lpage>497</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ar.1092310411</pubid>
                  <pubid idtype="pmpid">1793176</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Blockade of 1-methyl-4-phenylpyridinium ion (MPP+) nigral toxicity in the rat by prior decortication or MK-801 treatment: a stereological estimate of neuronal loss</p>
            </title>
            <aug>
               <au>
                  <snm>Srivastava</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Brouillet</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Beal</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Storey</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Hyman</snm>
                  <fnm>BT</fnm>
               </au>
            </aug>
            <source>Neurobiol Aging</source>
            <pubdate>1993</pubdate>
            <volume>14</volume>
            <fpage>295</fpage>
            <lpage>301</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0197-4580(93)90114-Q</pubid>
                  <pubid idtype="pmpid">8103573</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Primer3</p>
            </title>
            <url>http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi</url>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Establishment and characterization of immortalized clonal cell lines from fetal rat mesencephalic tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Prasad</snm>
                  <fnm>KN</fnm>
               </au>
               <au>
                  <snm>Carvalho</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kentroti</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Edwards-Prasad</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Freed</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Vernadakis</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>In Vitro Cell Dev Biol Anim</source>
            <pubdate>1994</pubdate>
            <volume>30A</volume>
            <fpage>596</fpage>
            <lpage>603</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7820310</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

